ID: 911239531

View in Genome Browser
Species Human (GRCh38)
Location 1:95449749-95449771
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239525_911239531 6 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data
911239522_911239531 9 Left 911239522 1:95449717-95449739 CCCCCAAACATGCAGATTCTCTC No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data
911239523_911239531 8 Left 911239523 1:95449718-95449740 CCCCAAACATGCAGATTCTCTCT No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data
911239524_911239531 7 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239531 1:95449749-95449771 CATGACTGCTGCTGGGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr