ID: 911239533

View in Genome Browser
Species Human (GRCh38)
Location 1:95449755-95449777
Sequence TGCTGCTGGGGAACAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239524_911239533 13 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239522_911239533 15 Left 911239522 1:95449717-95449739 CCCCCAAACATGCAGATTCTCTC No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239526_911239533 -9 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239523_911239533 14 Left 911239523 1:95449718-95449740 CCCCAAACATGCAGATTCTCTCT No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data
911239525_911239533 12 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239533 1:95449755-95449777 TGCTGCTGGGGAACAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239533 Original CRISPR TGCTGCTGGGGAACAGGAGA GGG Intergenic
No off target data available for this crispr