ID: 911239534

View in Genome Browser
Species Human (GRCh38)
Location 1:95449756-95449778
Sequence GCTGCTGGGGAACAGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239524_911239534 14 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239523_911239534 15 Left 911239523 1:95449718-95449740 CCCCAAACATGCAGATTCTCTCT No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239526_911239534 -8 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239525_911239534 13 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data
911239522_911239534 16 Left 911239522 1:95449717-95449739 CCCCCAAACATGCAGATTCTCTC No data
Right 911239534 1:95449756-95449778 GCTGCTGGGGAACAGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239534 Original CRISPR GCTGCTGGGGAACAGGAGAG GGG Intergenic