ID: 911239535

View in Genome Browser
Species Human (GRCh38)
Location 1:95449759-95449781
Sequence GCTGGGGAACAGGAGAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911239530_911239535 -10 Left 911239530 1:95449746-95449768 CCACATGACTGCTGCTGGGGAAC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239522_911239535 19 Left 911239522 1:95449717-95449739 CCCCCAAACATGCAGATTCTCTC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239526_911239535 -5 Left 911239526 1:95449741-95449763 CCAAGCCACATGACTGCTGCTGG No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239524_911239535 17 Left 911239524 1:95449719-95449741 CCCAAACATGCAGATTCTCTCTC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239525_911239535 16 Left 911239525 1:95449720-95449742 CCAAACATGCAGATTCTCTCTCC No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data
911239523_911239535 18 Left 911239523 1:95449718-95449740 CCCCAAACATGCAGATTCTCTCT No data
Right 911239535 1:95449759-95449781 GCTGGGGAACAGGAGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911239535 Original CRISPR GCTGGGGAACAGGAGAGGGG TGG Intergenic