ID: 911244632

View in Genome Browser
Species Human (GRCh38)
Location 1:95503428-95503450
Sequence CTGCTGTATTTGGGGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911244627_911244632 13 Left 911244627 1:95503392-95503414 CCTAACATCTGATTTGAAACACT No data
Right 911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG No data
911244626_911244632 30 Left 911244626 1:95503375-95503397 CCAGCTTGGTCTCTCTGCCTAAC No data
Right 911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911244632 Original CRISPR CTGCTGTATTTGGGGAATAA AGG Intergenic
No off target data available for this crispr