ID: 911249689

View in Genome Browser
Species Human (GRCh38)
Location 1:95560728-95560750
Sequence GAATTCTGTAGAATTTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911249689_911249691 0 Left 911249689 1:95560728-95560750 CCTGAGCAAATTCTACAGAATTC No data
Right 911249691 1:95560751-95560773 AGCCACCAGTGGATTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911249689 Original CRISPR GAATTCTGTAGAATTTGCTC AGG (reversed) Intergenic
No off target data available for this crispr