ID: 911259885

View in Genome Browser
Species Human (GRCh38)
Location 1:95673075-95673097
Sequence CCAGGGCTGCAGTTGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911259885_911259891 18 Left 911259885 1:95673075-95673097 CCTTCCAACAACTGCAGCCCTGG No data
Right 911259891 1:95673116-95673138 CCTCATGAAAGACCCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911259885 Original CRISPR CCAGGGCTGCAGTTGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr