ID: 911261510

View in Genome Browser
Species Human (GRCh38)
Location 1:95691976-95691998
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911261504_911261510 20 Left 911261504 1:95691933-95691955 CCAGGAGATGGGATCATGCTTTT No data
Right 911261510 1:95691976-95691998 CCCCGCCCGTACTTTGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr