ID: 911263452

View in Genome Browser
Species Human (GRCh38)
Location 1:95715243-95715265
Sequence ATTCTTACCCTGCTCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911263449_911263452 -5 Left 911263449 1:95715225-95715247 CCCACTAGAACCAGATAAATTCT No data
Right 911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG No data
911263448_911263452 -4 Left 911263448 1:95715224-95715246 CCCCACTAGAACCAGATAAATTC No data
Right 911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG No data
911263450_911263452 -6 Left 911263450 1:95715226-95715248 CCACTAGAACCAGATAAATTCTT No data
Right 911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG No data
911263447_911263452 2 Left 911263447 1:95715218-95715240 CCAGAACCCCACTAGAACCAGAT No data
Right 911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911263452 Original CRISPR ATTCTTACCCTGCTCCTGCC TGG Intergenic
No off target data available for this crispr