ID: 911267068

View in Genome Browser
Species Human (GRCh38)
Location 1:95754588-95754610
Sequence AAGGGCAAGCAGGGCGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911267068_911267078 1 Left 911267068 1:95754588-95754610 CCCTCAACGCCCTGCTTGCCCTT No data
Right 911267078 1:95754612-95754634 GCAGGCACGAAATCCAGGCTGGG No data
911267068_911267076 -4 Left 911267068 1:95754588-95754610 CCCTCAACGCCCTGCTTGCCCTT No data
Right 911267076 1:95754607-95754629 CCTTGGCAGGCACGAAATCCAGG No data
911267068_911267081 28 Left 911267068 1:95754588-95754610 CCCTCAACGCCCTGCTTGCCCTT No data
Right 911267081 1:95754639-95754661 TGAGCCAAGCGCAGCCTGCTGGG 0: 6
1: 20
2: 107
3: 186
4: 399
911267068_911267077 0 Left 911267068 1:95754588-95754610 CCCTCAACGCCCTGCTTGCCCTT No data
Right 911267077 1:95754611-95754633 GGCAGGCACGAAATCCAGGCTGG No data
911267068_911267080 27 Left 911267068 1:95754588-95754610 CCCTCAACGCCCTGCTTGCCCTT No data
Right 911267080 1:95754638-95754660 ATGAGCCAAGCGCAGCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911267068 Original CRISPR AAGGGCAAGCAGGGCGTTGA GGG (reversed) Intergenic
No off target data available for this crispr