ID: 911269113

View in Genome Browser
Species Human (GRCh38)
Location 1:95778996-95779018
Sequence CTGTGAATAATGAGTTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911269113_911269116 -5 Left 911269113 1:95778996-95779018 CCTTTCTAACTCATTATTCACAG No data
Right 911269116 1:95779014-95779036 CACAGGATGTTCCTGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911269113 Original CRISPR CTGTGAATAATGAGTTAGAA AGG (reversed) Intergenic
No off target data available for this crispr