ID: 911269404

View in Genome Browser
Species Human (GRCh38)
Location 1:95782131-95782153
Sequence TTCCTCAGTGATGTGTAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911269402_911269404 17 Left 911269402 1:95782091-95782113 CCTGTGATTGAGTGTGTATGGTA No data
Right 911269404 1:95782131-95782153 TTCCTCAGTGATGTGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911269404 Original CRISPR TTCCTCAGTGATGTGTAATA TGG Intergenic
No off target data available for this crispr