ID: 911272394

View in Genome Browser
Species Human (GRCh38)
Location 1:95818589-95818611
Sequence CTGCAAGTAGAGATGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911272394_911272396 17 Left 911272394 1:95818589-95818611 CCATTCTCCATCTCTACTTGCAG No data
Right 911272396 1:95818629-95818651 TGAATTTCTCTCTCTTTTATAGG No data
911272394_911272397 18 Left 911272394 1:95818589-95818611 CCATTCTCCATCTCTACTTGCAG No data
Right 911272397 1:95818630-95818652 GAATTTCTCTCTCTTTTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911272394 Original CRISPR CTGCAAGTAGAGATGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr