ID: 911277434

View in Genome Browser
Species Human (GRCh38)
Location 1:95879292-95879314
Sequence CAGGCCATGAAAGCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911277434_911277442 24 Left 911277434 1:95879292-95879314 CCTGCAGCTGCTTTCATGGCCTG No data
Right 911277442 1:95879339-95879361 AGGAACCTGGTGCAAGCTGTTGG No data
911277434_911277443 27 Left 911277434 1:95879292-95879314 CCTGCAGCTGCTTTCATGGCCTG No data
Right 911277443 1:95879342-95879364 AACCTGGTGCAAGCTGTTGGTGG No data
911277434_911277437 4 Left 911277434 1:95879292-95879314 CCTGCAGCTGCTTTCATGGCCTG No data
Right 911277437 1:95879319-95879341 TGAATCCCTGCAGCTTTTCCAGG No data
911277434_911277440 11 Left 911277434 1:95879292-95879314 CCTGCAGCTGCTTTCATGGCCTG No data
Right 911277440 1:95879326-95879348 CTGCAGCTTTTCCAGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911277434 Original CRISPR CAGGCCATGAAAGCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr