ID: 911281120

View in Genome Browser
Species Human (GRCh38)
Location 1:95930375-95930397
Sequence CTGAATCTTGAATGATTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911281118_911281120 22 Left 911281118 1:95930330-95930352 CCAAGAAATATGCAAAGACATTC No data
Right 911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG No data
911281119_911281120 0 Left 911281119 1:95930352-95930374 CCATTTACTTTCTGATTGTAATG No data
Right 911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911281120 Original CRISPR CTGAATCTTGAATGATTTGT AGG Intergenic
No off target data available for this crispr