ID: 911283102

View in Genome Browser
Species Human (GRCh38)
Location 1:95955875-95955897
Sequence ATGACCATGTCTCCTTTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911283100_911283102 14 Left 911283100 1:95955838-95955860 CCGGACACAGCAGTAGCGTGGAC No data
Right 911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG No data
911283098_911283102 24 Left 911283098 1:95955828-95955850 CCAATGGAAACCGGACACAGCAG 0: 60
1: 137
2: 107
3: 135
4: 212
Right 911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG No data
911283097_911283102 28 Left 911283097 1:95955824-95955846 CCAGCCAATGGAAACCGGACACA 0: 59
1: 137
2: 143
3: 138
4: 179
Right 911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911283102 Original CRISPR ATGACCATGTCTCCTTTGTT CGG Intergenic
No off target data available for this crispr