ID: 911284693

View in Genome Browser
Species Human (GRCh38)
Location 1:95975209-95975231
Sequence AAGAATGAGGAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911284693_911284705 24 Left 911284693 1:95975209-95975231 CCACCCTCCTTCTCCTCATTCTT No data
Right 911284705 1:95975256-95975278 CAGTCCCAGTGAGATGAACTGGG 0: 85
1: 584
2: 1019
3: 1198
4: 893
911284693_911284704 23 Left 911284693 1:95975209-95975231 CCACCCTCCTTCTCCTCATTCTT No data
Right 911284704 1:95975255-95975277 CCAGTCCCAGTGAGATGAACTGG 0: 112
1: 345
2: 406
3: 265
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911284693 Original CRISPR AAGAATGAGGAGAAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr