ID: 911292275

View in Genome Browser
Species Human (GRCh38)
Location 1:96071544-96071566
Sequence AGTTAGATTCAGAACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911292268_911292275 7 Left 911292268 1:96071514-96071536 CCCTTCTCACACTCTCCTGGTGG No data
Right 911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG No data
911292270_911292275 6 Left 911292270 1:96071515-96071537 CCTTCTCACACTCTCCTGGTGGC No data
Right 911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG No data
911292265_911292275 22 Left 911292265 1:96071499-96071521 CCTCCTTAATGGAGTCCCTTCTC No data
Right 911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG No data
911292266_911292275 19 Left 911292266 1:96071502-96071524 CCTTAATGGAGTCCCTTCTCACA No data
Right 911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG No data
911292271_911292275 -8 Left 911292271 1:96071529-96071551 CCTGGTGGCTTCCTAAGTTAGAT No data
Right 911292275 1:96071544-96071566 AGTTAGATTCAGAACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911292275 Original CRISPR AGTTAGATTCAGAACTTGGG AGG Intergenic
No off target data available for this crispr