ID: 911293220

View in Genome Browser
Species Human (GRCh38)
Location 1:96082613-96082635
Sequence TTGGTAATGTGGCCATTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911293216_911293220 26 Left 911293216 1:96082564-96082586 CCACTGCAGATGAAAGAGATGGC No data
Right 911293220 1:96082613-96082635 TTGGTAATGTGGCCATTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911293220 Original CRISPR TTGGTAATGTGGCCATTGGC TGG Intergenic
No off target data available for this crispr