ID: 911293221

View in Genome Browser
Species Human (GRCh38)
Location 1:96082614-96082636
Sequence TGGTAATGTGGCCATTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911293216_911293221 27 Left 911293216 1:96082564-96082586 CCACTGCAGATGAAAGAGATGGC No data
Right 911293221 1:96082614-96082636 TGGTAATGTGGCCATTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911293221 Original CRISPR TGGTAATGTGGCCATTGGCT GGG Intergenic
No off target data available for this crispr