ID: 911293961

View in Genome Browser
Species Human (GRCh38)
Location 1:96090819-96090841
Sequence TTATGCAGCTGTGAAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911293961_911293964 30 Left 911293961 1:96090819-96090841 CCTCTTTTTTCACAGCTGCATAA No data
Right 911293964 1:96090872-96090894 TTTAACCAGTACCCCATAGATGG No data
911293961_911293962 -8 Left 911293961 1:96090819-96090841 CCTCTTTTTTCACAGCTGCATAA No data
Right 911293962 1:96090834-96090856 CTGCATAATATTCCAACATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911293961 Original CRISPR TTATGCAGCTGTGAAAAAAG AGG (reversed) Intergenic
No off target data available for this crispr