ID: 911297008

View in Genome Browser
Species Human (GRCh38)
Location 1:96130036-96130058
Sequence TATTAGCTAGATCACGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911297008_911297012 -6 Left 911297008 1:96130036-96130058 CCACCACCGTGATCTAGCTAATA No data
Right 911297012 1:96130053-96130075 CTAATAATAATAACAACAAAGGG No data
911297008_911297011 -7 Left 911297008 1:96130036-96130058 CCACCACCGTGATCTAGCTAATA No data
Right 911297011 1:96130052-96130074 GCTAATAATAATAACAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911297008 Original CRISPR TATTAGCTAGATCACGGTGG TGG (reversed) Intergenic
No off target data available for this crispr