ID: 911303408

View in Genome Browser
Species Human (GRCh38)
Location 1:96204073-96204095
Sequence CGTCACATTCTGAAGTAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911303400_911303408 26 Left 911303400 1:96204024-96204046 CCCACCATAATAGCTTAATCTCC No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data
911303404_911303408 5 Left 911303404 1:96204045-96204067 CCTCTTCAAAGGCCCTATCTCCA No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data
911303406_911303408 -8 Left 911303406 1:96204058-96204080 CCTATCTCCAAATATCGTCACAT No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data
911303405_911303408 -7 Left 911303405 1:96204057-96204079 CCCTATCTCCAAATATCGTCACA No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data
911303402_911303408 22 Left 911303402 1:96204028-96204050 CCATAATAGCTTAATCTCCTCTT No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data
911303401_911303408 25 Left 911303401 1:96204025-96204047 CCACCATAATAGCTTAATCTCCT No data
Right 911303408 1:96204073-96204095 CGTCACATTCTGAAGTAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911303408 Original CRISPR CGTCACATTCTGAAGTAGTT AGG Intergenic
No off target data available for this crispr