ID: 911304612

View in Genome Browser
Species Human (GRCh38)
Location 1:96217662-96217684
Sequence CCTAGAAGATAGAACCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911304609_911304612 8 Left 911304609 1:96217631-96217653 CCATCTTTAACAGGAAGACAGAA No data
Right 911304612 1:96217662-96217684 CCTAGAAGATAGAACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911304612 Original CRISPR CCTAGAAGATAGAACCCTGA TGG Intergenic
No off target data available for this crispr