ID: 911304981

View in Genome Browser
Species Human (GRCh38)
Location 1:96222691-96222713
Sequence ATGTAGCCAGGGATGGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911304981_911304987 -9 Left 911304981 1:96222691-96222713 CCTACCTCCATCCCTGGCTACAT No data
Right 911304987 1:96222705-96222727 TGGCTACATGGTAATAATGAAGG No data
911304981_911304988 21 Left 911304981 1:96222691-96222713 CCTACCTCCATCCCTGGCTACAT No data
Right 911304988 1:96222735-96222757 CAGAAGTTTCTTTCCTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911304981 Original CRISPR ATGTAGCCAGGGATGGAGGT AGG (reversed) Intergenic
No off target data available for this crispr