ID: 911304981 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:96222691-96222713 |
| Sequence | ATGTAGCCAGGGATGGAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 911304981_911304987 | -9 | Left | 911304981 | 1:96222691-96222713 | CCTACCTCCATCCCTGGCTACAT | No data | ||
| Right | 911304987 | 1:96222705-96222727 | TGGCTACATGGTAATAATGAAGG | No data | ||||
| 911304981_911304988 | 21 | Left | 911304981 | 1:96222691-96222713 | CCTACCTCCATCCCTGGCTACAT | No data | ||
| Right | 911304988 | 1:96222735-96222757 | CAGAAGTTTCTTTCCTTTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 911304981 | Original CRISPR | ATGTAGCCAGGGATGGAGGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||