ID: 911315608

View in Genome Browser
Species Human (GRCh38)
Location 1:96353143-96353165
Sequence CTCAAAGAAAAGGTGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 251}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911315608_911315613 10 Left 911315608 1:96353143-96353165 CCCTAGCTCACCTTTTCTTTGAG 0: 1
1: 0
2: 2
3: 22
4: 251
Right 911315613 1:96353176-96353198 TTCAAGTGCCTGTCTTTTCCAGG 0: 1
1: 0
2: 0
3: 26
4: 270
911315608_911315615 12 Left 911315608 1:96353143-96353165 CCCTAGCTCACCTTTTCTTTGAG 0: 1
1: 0
2: 2
3: 22
4: 251
Right 911315615 1:96353178-96353200 CAAGTGCCTGTCTTTTCCAGGGG 0: 1
1: 0
2: 2
3: 15
4: 208
911315608_911315614 11 Left 911315608 1:96353143-96353165 CCCTAGCTCACCTTTTCTTTGAG 0: 1
1: 0
2: 2
3: 22
4: 251
Right 911315614 1:96353177-96353199 TCAAGTGCCTGTCTTTTCCAGGG 0: 1
1: 0
2: 3
3: 15
4: 237
911315608_911315616 13 Left 911315608 1:96353143-96353165 CCCTAGCTCACCTTTTCTTTGAG 0: 1
1: 0
2: 2
3: 22
4: 251
Right 911315616 1:96353179-96353201 AAGTGCCTGTCTTTTCCAGGGGG 0: 1
1: 0
2: 5
3: 17
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911315608 Original CRISPR CTCAAAGAAAAGGTGAGCTA GGG (reversed) Intergenic
901671660 1:10859846-10859868 CTCAAAGAGAAGGAGAACTGGGG - Intergenic
902418826 1:16261282-16261304 CTCCAAGGAAAGGTAAGCTGAGG + Intronic
905748229 1:40437594-40437616 CTCAAAGAAAAGGGCACCTGTGG + Intergenic
905826162 1:41027571-41027593 CTCAAAGAGAAAGTGCCCTAGGG + Exonic
907318348 1:53587006-53587028 CACAGAGAAAGGGGGAGCTAAGG + Intronic
907736456 1:57117452-57117474 ATCACAGAACTGGTGAGCTATGG + Intronic
908400820 1:63771617-63771639 TCCAAAGAAAAGGTTAGCAATGG - Intergenic
909075790 1:71048475-71048497 CCCAACAAAAAGGTCAGCTATGG + Intergenic
909594893 1:77395595-77395617 CTCAAAGACAAAGTGAGCACAGG - Intronic
909917398 1:81337055-81337077 CTCAAAGAAGAGTTCAGCTGGGG + Intronic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
912060089 1:105657754-105657776 ATCAAAGAAGAGGAGAGCTCAGG + Intergenic
912963186 1:114214045-114214067 CTTAAAGAATAATTGAGCTAGGG - Intergenic
913733057 1:121737945-121737967 ATCAAAGCAAAGGTCAGCTCTGG + Intergenic
913733201 1:121739809-121739831 ATCAAAGCAAAGGTCAGCTCTGG + Intergenic
913764901 1:122178414-122178436 ATCAAAGCAAAGGTCAGCTCTGG - Intergenic
913785827 1:122451223-122451245 ATCAAAGCAAAGGTCAGCTCTGG - Intergenic
913787224 1:122470080-122470102 ATCAAAGCAAAGGTCAGCTCTGG - Intergenic
914833831 1:151190748-151190770 CTAAAAGAAAATGTGAGCTGGGG - Intronic
914880678 1:151544279-151544301 CCCAAAAAAAAGGTGATTTAAGG - Intronic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
916378353 1:164181056-164181078 TGCAAAGAAAAGCTGAGCCAGGG + Intergenic
917663243 1:177198096-177198118 AGCAAAGAAAATGTGAACTAAGG + Intronic
917909081 1:179622431-179622453 GACAAAGAAAAGGTGATCAATGG + Intronic
920609124 1:207420451-207420473 CTCAAAGATAAGGAGAGGGAAGG + Intergenic
921698281 1:218237644-218237666 CTCCAACAAAAAGTGAGCGAAGG + Intergenic
921989173 1:221345798-221345820 CTCACAGAAAATGTGATTTAGGG - Intergenic
1063359036 10:5433596-5433618 ATGAAAGAAAAGGTGAGCCATGG - Intronic
1063522985 10:6757840-6757862 CTCAGAGAGGAGGTGAGCTGTGG - Intergenic
1067789624 10:49277931-49277953 CTCAGAAAAATGGTGAGCTCGGG - Intergenic
1067841804 10:49686976-49686998 GTCAGAGAAAAGGTGAGGCAAGG + Intronic
1068387119 10:56345083-56345105 CTCAATGAAAATATGAGCAAAGG + Intergenic
1069622904 10:69848837-69848859 CACAAAGAGAAGGTGAGTTGTGG - Intronic
1070251121 10:74773868-74773890 CTCACAGCAAAGGTGAGAGAGGG + Intergenic
1070397002 10:76020096-76020118 ATCAAACACAAGGTGAGCTGAGG + Intronic
1071201899 10:83228706-83228728 CTCACAGAAAAGTAGAGCTGGGG - Intergenic
1071259946 10:83910651-83910673 CTCAAAGAGATGATGAGATAAGG - Intergenic
1072082332 10:92044716-92044738 CTCATAGAAAAGGGCATCTATGG - Intergenic
1072415159 10:95241148-95241170 CTGAAAGAACAAGAGAGCTAAGG - Intronic
1073311272 10:102544098-102544120 CACAAAAAAAAGATGAGCTTTGG + Intronic
1074649841 10:115508294-115508316 CTCAATGAAAAGGAGGCCTAAGG - Intronic
1075310410 10:121409121-121409143 TTCACAGAAAAGGTGAGGTTTGG - Intergenic
1075582674 10:123634095-123634117 GTCAAAGAAAGGGTGAGCTATGG - Intergenic
1077300662 11:1845591-1845613 TTCAAAGAAAAGTTTAGCTTTGG - Intergenic
1077905128 11:6526806-6526828 CTCCAAGAACAGGTGAGGTAAGG - Intronic
1079378096 11:19912169-19912191 GCCAAAGACAAGATGAGCTAGGG + Intronic
1079620912 11:22552786-22552808 CTGAAAGAAAAGCTAAGCCAAGG + Intergenic
1083158986 11:60842871-60842893 CTCCAAGAAAAGGTGAAGTGGGG + Exonic
1083970933 11:66074680-66074702 CTTAAAAAAAATGTGACCTAAGG - Intronic
1084059058 11:66657736-66657758 CTCAAAAAAAAGGTGGGGGAGGG - Intronic
1084630713 11:70347202-70347224 CTCTAAGAATAGGGGAGATAAGG + Intronic
1086065364 11:82738058-82738080 CTCAAAGGAAAGGAGATCAAGGG - Intergenic
1086131879 11:83409601-83409623 CTCAAAGAGCAGGTGGGCTCTGG - Intergenic
1087344929 11:96959935-96959957 CCCAAAGAAAAATTGAGATATGG + Intergenic
1087862883 11:103184603-103184625 ATAAAAGAAAAGGTAAGTTAGGG - Intronic
1089831699 11:121334693-121334715 CTGAATGAAGAGGTGATCTAAGG - Intergenic
1091815102 12:3431820-3431842 TTGAAAGAGAAGGTGAGATATGG + Intronic
1091866756 12:3845087-3845109 CACAAAAAACAGGTGAGCTTTGG - Intronic
1094541277 12:31365044-31365066 CTTAAAGAAATGGTGAGAGATGG + Intergenic
1095972602 12:47913226-47913248 CTCCAAGTTAAGGTGAGCTTTGG - Intronic
1096683954 12:53275458-53275480 CTCAAAAAAAAAGTGAGTTGGGG + Intronic
1097013843 12:55971567-55971589 CTGGAAGAAAGGGTGAGCCAGGG - Exonic
1097703144 12:62840608-62840630 CTCAGAGAAAAGGTAAGAAAAGG + Intronic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1099794968 12:87388159-87388181 ATGGAAGAAAAGGTGAGCTATGG - Intergenic
1102424711 12:112833795-112833817 GTCAAAGCTAAAGTGAGCTATGG - Intronic
1102978076 12:117220780-117220802 CAGAAGGAAAAGGTGGGCTAAGG + Intronic
1103559149 12:121783319-121783341 CTCAAAGAAAAGGTGGGGGGGGG - Intronic
1104515352 12:129420122-129420144 CTCAGAGGAAAGGTGTGCTGTGG + Intronic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1106276436 13:28212797-28212819 CGCAGAGAAAATGTGAGCCATGG + Intronic
1107108114 13:36668248-36668270 CTCAGATAATAGGGGAGCTATGG + Intergenic
1109673658 13:65642958-65642980 TTTAAAGAAAAGGTAAGCTTGGG + Intergenic
1110577657 13:77078486-77078508 CTCAAAGTATAGGTGAAGTAAGG + Intronic
1111327187 13:86714352-86714374 CTGAAAGCAAAGGTGGGCAAGGG + Intergenic
1114172905 14:20291972-20291994 CACAAAGGAAAGGTGAGCAATGG - Exonic
1114405624 14:22453449-22453471 ATCAGAGAAAAAGTCAGCTATGG + Intergenic
1114894573 14:26970934-26970956 CTCAAGGAAAAGGTGGGTGAAGG + Intergenic
1114944720 14:27665414-27665436 CCCAAACAAAAAGTGAGCAAAGG - Intergenic
1115670125 14:35601433-35601455 CTCACAGCAAAGGTCAGGTAAGG - Intronic
1115813223 14:37133359-37133381 CTCACAGAGACTGTGAGCTAAGG - Intronic
1116552246 14:46256260-46256282 CTCTAAGAAATGGTGAGTAAGGG - Intergenic
1119707263 14:76790824-76790846 CCCATAGAAAAAGTGATCTAGGG - Intronic
1120788636 14:88559371-88559393 CTCAAAGAAAAGCAAAGCTTTGG + Intergenic
1121588193 14:95078482-95078504 TAAAAAGAAAAGGTCAGCTACGG + Intergenic
1121682609 14:95806407-95806429 CTCAAAAAAAAAGTGAGATTGGG + Intergenic
1122089691 14:99330169-99330191 CTCGAAGAAGAGGTGAGGAAAGG + Intergenic
1124620970 15:31273735-31273757 CTCAGAGGAGAGGTGAGCGAAGG + Intergenic
1125270882 15:37937385-37937407 CTTCAACAAAAGGTGAGGTAGGG + Exonic
1127752772 15:62062047-62062069 CCCAAAGCACAGGTGAGCTTAGG + Intergenic
1127920471 15:63490492-63490514 CTCAAAAAAAAGGGGAACTCTGG + Intergenic
1128263824 15:66251857-66251879 CTTAAACAAAATGTGAGCAACGG + Intronic
1131815280 15:96215521-96215543 CTCACAGAAAATGTTAGCTGTGG - Intergenic
1132783939 16:1644029-1644051 GCAAAAGAAAAGGTGAGCTCAGG + Intronic
1133095333 16:3441243-3441265 CTCTAAGAAAAGGAGAGGTTTGG + Intronic
1135667427 16:24347614-24347636 GTCAAAGAAGAGGTGAACTTGGG - Intronic
1136017012 16:27406815-27406837 CTCAAAGAAAGGCAGAGATACGG + Intronic
1136420315 16:30128160-30128182 CTCAGAAGAAAGTTGAGCTAAGG - Intergenic
1136533905 16:30887964-30887986 CTCAAAGACAGGGTAAGCTTCGG + Intronic
1137349523 16:47699991-47700013 CTCAAAGAAAATGTTTGATAAGG - Exonic
1137552878 16:49452666-49452688 TTGAAAGGAAAGGTGAGCCAAGG - Intergenic
1139231211 16:65284208-65284230 CAGAAAGAATAAGTGAGCTATGG - Intergenic
1141331967 16:83118987-83119009 ATAGAAGAAAAGGAGAGCTATGG - Intronic
1141337044 16:83165817-83165839 CTCCAAGAAAAGGAGAGGTAAGG - Intronic
1146660291 17:34661126-34661148 TGTAAAGAAAAGGTGAGATATGG - Intergenic
1146739742 17:35272696-35272718 CTCAAAGGAAAAATGAGCAAAGG + Exonic
1150242557 17:63646941-63646963 CTCAAAGCAAAGGAAAGCTGAGG - Intronic
1153277525 18:3382260-3382282 CTTCAACAAAAGGTGAGGTAAGG + Intergenic
1154372932 18:13781135-13781157 CTCAAAAAAAAAGTGGGCAAAGG + Intergenic
1155300976 18:24428467-24428489 ATAAATGAAAAGGTCAGCTATGG + Intronic
1159225920 18:65535948-65535970 CTCCATGAAAAAGTGGGCTAAGG + Intergenic
1160034472 18:75287562-75287584 CTCAAAGCAAAGGTCACCAACGG + Exonic
1161822047 19:6535566-6535588 CTGAAAGAAAATCTGAGTTATGG + Exonic
1162161741 19:8723139-8723161 CTGAAAGGAAAGGTGAGTTTGGG + Intergenic
1162231042 19:9266973-9266995 CCCAAAGAAAACATGAGCCAAGG - Intergenic
1162558956 19:11404889-11404911 CACAAAGAAAAGGTTACTTAAGG - Intronic
1162650835 19:12087773-12087795 CAGAAAGAAAAGGGGAGATAGGG - Intergenic
1164805002 19:31109662-31109684 CTGAAAGAAAAGGAGGGCAAGGG + Intergenic
1165075320 19:33277073-33277095 CACAAAGGAAAGGAGAGCTGAGG + Intergenic
1167840180 19:52110286-52110308 CACAAAGAAAATGTGATTTAAGG + Intergenic
927231707 2:20830415-20830437 CTCAAAAAAAAGGAGAGGTGGGG - Intergenic
928133668 2:28672013-28672035 ATCAAAGGAAAGGGGAACTAAGG + Intergenic
929716952 2:44321965-44321987 CTCAAAGAAGAGGGGAGGAATGG - Intronic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
931645129 2:64415458-64415480 CCCATAGAAAATGTGAGATAAGG + Intergenic
932333853 2:70918216-70918238 CTCAGGGAAAAGGTGAGCCAGGG - Intronic
934040024 2:88120356-88120378 GTCAATGGAAAGGTGAGTTAAGG - Intergenic
934488201 2:94737611-94737633 CTCAAGGCAATGGTCAGCTACGG + Intergenic
936469846 2:112789416-112789438 ATCAGAGAACAGATGAGCTAAGG - Intergenic
937003009 2:118485265-118485287 CTCAAAAAAAAGGTAAACTGAGG + Intergenic
938291115 2:130151042-130151064 CTCAAAGAAAAGCTGACCACCGG - Intergenic
938465428 2:131521917-131521939 CTCAAAGAAAAGCTGACCACCGG + Intergenic
940662745 2:156567781-156567803 TTAAGAGAGAAGGTGAGCTATGG - Intronic
942371294 2:175288547-175288569 CTAAAAGAAAGGCTGAGCTCAGG - Intergenic
942510925 2:176699696-176699718 TTCAAAGAAGAGGTGAGAAATGG - Intergenic
942896843 2:181067334-181067356 CTCAAAGTGAAGATCAGCTAAGG - Intronic
943982470 2:194572294-194572316 CAGAAAGAAAAGCTGAGCTGTGG + Intergenic
944297056 2:198077509-198077531 CTAAAAGAAAAGAAGAGCTGAGG - Intronic
945366722 2:208963927-208963949 CTCCATGAAAAAGTGAGCAAAGG + Intergenic
946370919 2:219280737-219280759 CTTTAAGAAAATGTGAGCTGGGG - Intronic
946582566 2:221145599-221145621 CCCAAAGAAAAGGTCATCTGAGG + Intergenic
947020118 2:225665564-225665586 CTCAAAAAAAAAAGGAGCTAGGG - Intergenic
947206703 2:227667431-227667453 CTCATAGAAAAGGTGGGAAATGG - Intergenic
948347152 2:237308213-237308235 CCCAGAGAACAGGTGGGCTATGG + Intergenic
948355242 2:237372504-237372526 ATCAAAGAGAAGGGGAGCAAAGG + Intronic
1169227476 20:3865533-3865555 CTCCAAGAAAAGGTGGCCTAGGG + Intronic
1169617384 20:7464086-7464108 CTCAAAAAAATGTAGAGCTATGG + Intergenic
1170392331 20:15889210-15889232 GTCAATGAATAGGAGAGCTAGGG + Intronic
1171189926 20:23151516-23151538 GTCAAACAAAAGGTGAGGTCAGG - Intergenic
1171303046 20:24080407-24080429 CTAAAAGAAGAGGAGACCTAGGG - Intergenic
1173331299 20:42078190-42078212 CTCAAAGCAAAGGCAAGCAAAGG - Exonic
1174650536 20:52121104-52121126 CTCGAAGAAAAGGAGAGAGAAGG - Intronic
1175050342 20:56149906-56149928 TTGCAAGAAAAGGGGAGCTATGG - Intergenic
1175680799 20:60987149-60987171 CACAAGGAAGAGGTGAGCTGTGG - Intergenic
1177731997 21:25039070-25039092 CTCAAAGGAAAGGTAGGCTATGG + Intergenic
1180800556 22:18629957-18629979 CTCAAAGAAGAGGTCAGCTCAGG + Intergenic
1180851789 22:19025514-19025536 CTCAAAGAAGAGGTCAGCTCAGG + Intergenic
1180970312 22:19811710-19811732 CTCAGGGGAAAGGTGAGCTAGGG - Intronic
1181221163 22:21365305-21365327 CTCAAAGAAGAGGTCAGCTCAGG - Intergenic
1184229159 22:43149082-43149104 GTCAAAGTAAAGGTGATCTCTGG + Intergenic
949148780 3:738821-738843 CCCAAAGAAAATGTGATGTATGG - Intergenic
949548024 3:5089381-5089403 CCCAAAGAGAGGGTGAACTAGGG - Intergenic
949953539 3:9248874-9248896 CCCAAATAAAAGGTGAGATGCGG - Exonic
951418141 3:22449903-22449925 CTCAAAAACAAGGTCAGCTTGGG - Intergenic
951514052 3:23538389-23538411 TACAAAGAAAAGGAAAGCTATGG + Intronic
951526057 3:23654185-23654207 CTTAAACTAAATGTGAGCTAAGG + Intergenic
953478442 3:43226784-43226806 CACAATGAAAAGGCAAGCTATGG + Intergenic
954723367 3:52585307-52585329 CTTAAAGAAAAAGTCACCTATGG + Intronic
955177271 3:56629357-56629379 GGAAAGGAAAAGGTGAGCTAGGG - Intronic
955904408 3:63791441-63791463 CTGAGAGAAAAGGTGAGCTCAGG + Intergenic
957505005 3:81108134-81108156 CACAAAGAGAAGGTGAGTTTTGG - Intergenic
957634058 3:82759189-82759211 CTAAAGGAAAAGGTGAACTCAGG + Intergenic
957705984 3:83784749-83784771 CTCAAAGAAACTGTGTGATATGG + Intergenic
958942085 3:100327946-100327968 CACAAAAAAAAAGTGTGCTAAGG + Intergenic
959257182 3:104030777-104030799 CTTAAAGAAAGGGTGAGTGAAGG + Intergenic
962730731 3:138281250-138281272 CTCATTGAATATGTGAGCTAAGG - Intronic
965607749 3:170513364-170513386 GTCAAAGAAATGATAAGCTAGGG + Intronic
966749202 3:183305847-183305869 CTCAAAAAAAAGGGCAACTAAGG + Intronic
970181621 4:13403094-13403116 TTCAAAGAATATGTGAGCCAGGG - Intronic
973775384 4:54236967-54236989 CTCAAAAAAAAAGTGGGCAATGG - Intronic
973825681 4:54704385-54704407 CTTAGAGAACAGGTGAGATAAGG - Intronic
974321611 4:60356930-60356952 CTCCATCAAAAAGTGAGCTAAGG + Intergenic
974861625 4:67529150-67529172 CCCAAATAAAAGATGAGCAAAGG - Intronic
976270509 4:83225730-83225752 TTCAAAGAAAATTTGAGCTTAGG - Intergenic
977207222 4:94177037-94177059 CTCAAGGAAAAGTGGAGGTAGGG + Intergenic
978545731 4:109870656-109870678 CTCAAAGTGTAGGTGAGCTCTGG + Exonic
980599344 4:134999099-134999121 CTTAAAGAATAGGTGTTCTAAGG + Intergenic
981471006 4:145134826-145134848 CACAAAAAACAGGTGAGCTTTGG + Exonic
982461423 4:155674053-155674075 CTCAGTGAAAACGTGTGCTATGG + Intronic
982540016 4:156656960-156656982 TTCACAGAAAGGGTGAGATATGG - Intergenic
982768596 4:159375448-159375470 AGAAAAGAAAAGGTGAGCTGAGG - Intergenic
983269386 4:165543636-165543658 CTTAGAGAAATGCTGAGCTAGGG - Intergenic
984894304 4:184523271-184523293 CTCAATTAAAAAGTGAGCAAAGG - Intergenic
987579505 5:19771613-19771635 CTCACAGAAACTGTGAGATAAGG + Intronic
988630723 5:32928497-32928519 TCCAAAGAACAGGTGAGATAAGG + Intergenic
989083290 5:37649176-37649198 CTCAAAGTAAAGGATAGCTTAGG + Intronic
993220227 5:85085889-85085911 CTCAAAATAAAAGTGAGATAAGG - Intergenic
994043932 5:95286600-95286622 GTGAAACAAAAGGTCAGCTAAGG + Intergenic
995001904 5:107143228-107143250 CTCAAAGAACAGGTTATCTGGGG - Intergenic
995711889 5:115044250-115044272 CTCCAATAAAAAGTGAGCAAAGG + Intergenic
995791890 5:115897860-115897882 CTTTAAGAAAATGTGAGCTGTGG - Intronic
996540147 5:124622872-124622894 CTCACAGAAAAGATGAGCAAAGG - Intergenic
996591230 5:125150060-125150082 GTCAAAGAAACAGTGAGCTTGGG - Intergenic
996620250 5:125492521-125492543 CTAAAAGACAATGTGAGATATGG + Intergenic
996714906 5:126579325-126579347 CTCCAAGAGAAGGTTAGCCAAGG - Intronic
999097984 5:148998383-148998405 CTCACAGAAAAGGACAGCAATGG + Intronic
1001443838 5:171767379-171767401 AGGAAAGAAAAGGTGAGCCAAGG + Intergenic
1001600607 5:172925877-172925899 CTCAGAGAAAAGGTGAGATGTGG + Intronic
1002681220 5:180966625-180966647 CTCAAAGAAAAGAACAGCCAAGG + Intergenic
1003322840 6:5067516-5067538 CTCAAAGCAAGGGAGAGCTGGGG + Intergenic
1004810354 6:19253354-19253376 CTCAAAGAAAAGGTGAAAAAGGG + Intergenic
1005451081 6:25973020-25973042 CAAAAAGAAAAGGTGAGCATGGG - Intronic
1005949264 6:30619272-30619294 CTGAAAGAAAAGCTAAGTTAGGG - Intronic
1006889984 6:37418597-37418619 CACAAAGAAATGGTGAAGTATGG - Intergenic
1008432678 6:51437323-51437345 ACCAAAGAAGAGGTGAGCTTTGG + Intergenic
1010885035 6:81226044-81226066 CTCAAGGAAAATATTAGCTAAGG - Intergenic
1011194204 6:84765200-84765222 TTGAAAGAAAAGGTGGGCTGCGG - Intergenic
1011937418 6:92798630-92798652 CTCAAAGAAAAAATAAACTATGG - Intergenic
1014389548 6:120843726-120843748 CACAAAGACAAGGTGGCCTACGG - Intergenic
1015408057 6:132859528-132859550 ATCAAAGAAAGGGGAAGCTAAGG + Intergenic
1015413438 6:132920975-132920997 CTCAAAGGAAAGGTGAGGGATGG - Intergenic
1015852418 6:137588326-137588348 CCCAAAGAAAGGGTGAGTAAAGG + Intergenic
1016488568 6:144570768-144570790 TTCAAAGGAAAAGTGAGCTAAGG - Intronic
1020595656 7:10204490-10204512 CACAAAGGAAAGGTAAGGTAAGG + Intergenic
1021474452 7:21044599-21044621 ATAAAAGAGAAGGTGAGATAGGG + Intergenic
1024328382 7:48131955-48131977 CTGAAAGAAGAGGTTTGCTATGG + Intergenic
1025035217 7:55589488-55589510 CTAAAAGAAAAGGAGAGGTGAGG - Intergenic
1027998761 7:85464099-85464121 ATCAAAGAAAAGGAGATCCAAGG - Intergenic
1028158893 7:87463883-87463905 CAGAAAGAAAAGGTGAGAAATGG - Intronic
1028799329 7:94944298-94944320 CTGAAAGAACAGGTGATCAAAGG - Intronic
1031033523 7:116761959-116761981 GTCAAAGAAAAGGAAATCTAAGG + Intronic
1031945764 7:127838502-127838524 CTCAAATAATAGGTTAACTATGG - Intronic
1032552821 7:132801712-132801734 TTAAAAGAAAAGGTTAGCTTTGG + Intronic
1033783036 7:144695382-144695404 GGCAAAGAAAATGAGAGCTAAGG + Intronic
1034529287 7:151685322-151685344 CTCAAAGAGAAGCTGAGCATGGG - Intronic
1034918354 7:155059331-155059353 CTGAAAGAAAAGGTAGGCTGAGG + Intergenic
1036065407 8:5375519-5375541 CTCAACGAAAAGTTAAGCCATGG + Intergenic
1040755352 8:50766974-50766996 TAAAAAGAAAAGGTGAGCCAGGG + Intronic
1040857305 8:51961387-51961409 CTCAGAGGAAAGGTGAGCCAAGG + Intergenic
1041742680 8:61173670-61173692 CTAAGAGAAAAGGGGAGCTCAGG + Intronic
1042746116 8:72108170-72108192 CTCAAAGAAAAGGAAATGTAGGG - Intronic
1042825037 8:72971615-72971637 CTGAAAGAAAAAGTTAACTAGGG + Intergenic
1043168121 8:76930318-76930340 TTCAAAGTTATGGTGAGCTATGG - Intergenic
1046426384 8:114056667-114056689 CTCACAGAAACTGGGAGCTAAGG - Intergenic
1046700066 8:117390548-117390570 CTCAAAGAAAGTGCGAGCCAAGG + Intergenic
1047039389 8:120975821-120975843 CTCATAGAAAAGATGACATATGG + Intergenic
1049935431 9:497371-497393 CTCAGAGAAAAGGTGAACTGGGG - Intronic
1050914871 9:11118942-11118964 GTCAAAGCAGAGGTGGGCTATGG - Intergenic
1051025903 9:12610527-12610549 CTCAAAGTAAAGGTGATGGAGGG + Intergenic
1052765994 9:32641471-32641493 CTCAAAGAAAAGGGAAGGGAAGG + Intergenic
1053669589 9:40346753-40346775 CTCAAGGCAATGGTCAGCTACGG - Intergenic
1054380722 9:64486773-64486795 CTCAAGGCAATGGTCAGCTACGG - Intergenic
1054515025 9:66029538-66029560 CTCAAGGCAATGGTCAGCTACGG + Intergenic
1055319284 9:75066392-75066414 ATAAAAGAAAAGGGGAGCTCTGG + Intronic
1058030542 9:100192073-100192095 CTGAAAGAAATGGTGGGCTGCGG - Intronic
1060214042 9:121727659-121727681 CCCAAAGAAATGGTGAGAAAAGG + Intronic
1060485661 9:124044995-124045017 AAAAAAGAAAAGGAGAGCTAAGG - Intergenic
1060704410 9:125784988-125785010 CTAAAAGAAAAGGCTAGCGAAGG - Intronic
1060985671 9:127817753-127817775 CTCAAAGAACAGGAGACCTGAGG - Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1062676278 9:137746679-137746701 TTAAAAGAAAATGTGAGGTAAGG + Intronic
1185824285 X:3234732-3234754 ATTAAAGAAAAGGTTAGCTGAGG - Intergenic
1186635902 X:11404645-11404667 CTCAAAGAAAATGTGGCCAAAGG + Intronic
1186701809 X:12098637-12098659 CCCAAAGAAATAGTTAGCTATGG + Intergenic
1188630800 X:32357521-32357543 CTCAAAAAAAGGGATAGCTATGG - Intronic
1190112700 X:47604967-47604989 CACAAAGAAATGGTGAGTTTGGG - Exonic
1192246725 X:69379099-69379121 CCCCAAGCAAAGGTGAGCTCTGG - Intergenic
1197160997 X:123321845-123321867 CACAAAGAGAAAATGAGCTATGG + Intronic
1197659202 X:129151621-129151643 CTCAAGGAAATGGTGAACTGGGG + Intergenic
1199641234 X:149864114-149864136 CCCAAAAAAAAAGTGAGCAAAGG + Intergenic
1200757890 Y:7008330-7008352 CTCAAAGACAAGCTGACCTCTGG - Intronic
1200793136 Y:7317119-7317141 CTCAAAGAAATAGTGAGGGATGG + Intergenic
1201105289 Y:10758903-10758925 GTCAAATGAAATGTGAGCTAAGG - Intergenic
1201128824 Y:10937342-10937364 GTGAAAGAAAACGTGAGCTTAGG - Intergenic
1201489069 Y:14522597-14522619 CTGCAAGAAAAAGAGAGCTAGGG - Intergenic