ID: 911320984

View in Genome Browser
Species Human (GRCh38)
Location 1:96413736-96413758
Sequence AGCTATCTGCAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911320981_911320984 9 Left 911320981 1:96413704-96413726 CCAGAATTTCTTATTCGGAAGGG No data
Right 911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG No data
911320978_911320984 27 Left 911320978 1:96413686-96413708 CCTAGAGTTGAAACAGCTCCAGA No data
Right 911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911320984 Original CRISPR AGCTATCTGCAGAAAGTGGA TGG Intergenic
No off target data available for this crispr