ID: 911323712

View in Genome Browser
Species Human (GRCh38)
Location 1:96444769-96444791
Sequence GATAAAGGAACCCAGATGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911323712_911323717 9 Left 911323712 1:96444769-96444791 CCTGACATCTGGGTTCCTTTATC No data
Right 911323717 1:96444801-96444823 GAAAATTCTTCGTTCACTTTTGG No data
911323712_911323718 16 Left 911323712 1:96444769-96444791 CCTGACATCTGGGTTCCTTTATC No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911323712 Original CRISPR GATAAAGGAACCCAGATGTC AGG (reversed) Intergenic
No off target data available for this crispr