ID: 911323713

View in Genome Browser
Species Human (GRCh38)
Location 1:96444784-96444806
Sequence ATTTTCACTTGAGGGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911323713_911323718 1 Left 911323713 1:96444784-96444806 CCTTTATCCCCTCAAGTGAAAAT No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data
911323713_911323717 -6 Left 911323713 1:96444784-96444806 CCTTTATCCCCTCAAGTGAAAAT No data
Right 911323717 1:96444801-96444823 GAAAATTCTTCGTTCACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911323713 Original CRISPR ATTTTCACTTGAGGGGATAA AGG (reversed) Intergenic
No off target data available for this crispr