ID: 911323716

View in Genome Browser
Species Human (GRCh38)
Location 1:96444793-96444815
Sequence GAACGAAGAATTTTCACTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911323716_911323718 -8 Left 911323716 1:96444793-96444815 CCTCAAGTGAAAATTCTTCGTTC No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911323716 Original CRISPR GAACGAAGAATTTTCACTTG AGG (reversed) Intergenic
No off target data available for this crispr