ID: 911323718

View in Genome Browser
Species Human (GRCh38)
Location 1:96444808-96444830
Sequence CTTCGTTCACTTTTGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911323716_911323718 -8 Left 911323716 1:96444793-96444815 CCTCAAGTGAAAATTCTTCGTTC No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data
911323713_911323718 1 Left 911323713 1:96444784-96444806 CCTTTATCCCCTCAAGTGAAAAT No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data
911323714_911323718 -6 Left 911323714 1:96444791-96444813 CCCCTCAAGTGAAAATTCTTCGT No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data
911323715_911323718 -7 Left 911323715 1:96444792-96444814 CCCTCAAGTGAAAATTCTTCGTT No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data
911323712_911323718 16 Left 911323712 1:96444769-96444791 CCTGACATCTGGGTTCCTTTATC No data
Right 911323718 1:96444808-96444830 CTTCGTTCACTTTTGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911323718 Original CRISPR CTTCGTTCACTTTTGGAAAA TGG Intergenic
No off target data available for this crispr