ID: 911327429

View in Genome Browser
Species Human (GRCh38)
Location 1:96484630-96484652
Sequence CCTTCTGGTGACAAAGATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911327429_911327434 26 Left 911327429 1:96484630-96484652 CCTCAATCTTTGTCACCAGAAGG No data
Right 911327434 1:96484679-96484701 TGGCACTTAAGGAATGTTTGTGG No data
911327429_911327433 15 Left 911327429 1:96484630-96484652 CCTCAATCTTTGTCACCAGAAGG No data
Right 911327433 1:96484668-96484690 ATTTTTATAATTGGCACTTAAGG No data
911327429_911327432 6 Left 911327429 1:96484630-96484652 CCTCAATCTTTGTCACCAGAAGG No data
Right 911327432 1:96484659-96484681 ACAATTACTATTTTTATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911327429 Original CRISPR CCTTCTGGTGACAAAGATTG AGG (reversed) Intergenic
No off target data available for this crispr