ID: 911327970

View in Genome Browser
Species Human (GRCh38)
Location 1:96491469-96491491
Sequence ATTCAAAAGACAGTGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911327970_911327972 12 Left 911327970 1:96491469-96491491 CCTCAACACACTGTCTTTTGAAT No data
Right 911327972 1:96491504-96491526 TTCGATGTCTACATAAATTATGG No data
911327970_911327973 24 Left 911327970 1:96491469-96491491 CCTCAACACACTGTCTTTTGAAT No data
Right 911327973 1:96491516-96491538 ATAAATTATGGTACCTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911327970 Original CRISPR ATTCAAAAGACAGTGTGTTG AGG (reversed) Intergenic
No off target data available for this crispr