ID: 911330786

View in Genome Browser
Species Human (GRCh38)
Location 1:96523469-96523491
Sequence TTAAGAATTTTGTAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911330786_911330795 27 Left 911330786 1:96523469-96523491 CCTGCCAACTACAAAATTCTTAA No data
Right 911330795 1:96523519-96523541 AGATTAAGTCATCAGATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911330786 Original CRISPR TTAAGAATTTTGTAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr