ID: 911335185

View in Genome Browser
Species Human (GRCh38)
Location 1:96573510-96573532
Sequence GATATCCAGGAGAGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911335185_911335194 15 Left 911335185 1:96573510-96573532 CCTCCTCCTCTCTCCTGGATATC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335185_911335195 16 Left 911335185 1:96573510-96573532 CCTCCTCCTCTCTCCTGGATATC No data
Right 911335195 1:96573549-96573571 GTCCTGCCCTGCTCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911335185 Original CRISPR GATATCCAGGAGAGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr