ID: 911335189

View in Genome Browser
Species Human (GRCh38)
Location 1:96573535-96573557
Sequence GGGCAGGACTGGGGAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911335189_911335194 -10 Left 911335189 1:96573535-96573557 CCTCCTTCTCCCCAGTCCTGCCC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335189_911335202 19 Left 911335189 1:96573535-96573557 CCTCCTTCTCCCCAGTCCTGCCC No data
Right 911335202 1:96573577-96573599 CCACACATCACAGCCACTGTAGG No data
911335189_911335195 -9 Left 911335189 1:96573535-96573557 CCTCCTTCTCCCCAGTCCTGCCC No data
Right 911335195 1:96573549-96573571 GTCCTGCCCTGCTCCTGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911335189 Original CRISPR GGGCAGGACTGGGGAGAAGG AGG (reversed) Intergenic
No off target data available for this crispr