ID: 911335194

View in Genome Browser
Species Human (GRCh38)
Location 1:96573548-96573570
Sequence AGTCCTGCCCTGCTCCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911335189_911335194 -10 Left 911335189 1:96573535-96573557 CCTCCTTCTCCCCAGTCCTGCCC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335186_911335194 12 Left 911335186 1:96573513-96573535 CCTCCTCTCTCCTGGATATCTTC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335187_911335194 9 Left 911335187 1:96573516-96573538 CCTCTCTCCTGGATATCTTCCTC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335188_911335194 2 Left 911335188 1:96573523-96573545 CCTGGATATCTTCCTCCTTCTCC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335185_911335194 15 Left 911335185 1:96573510-96573532 CCTCCTCCTCTCTCCTGGATATC No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data
911335183_911335194 29 Left 911335183 1:96573496-96573518 CCAAGGGTTCTTCACCTCCTCCT No data
Right 911335194 1:96573548-96573570 AGTCCTGCCCTGCTCCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911335194 Original CRISPR AGTCCTGCCCTGCTCCTGAC TGG Intergenic
No off target data available for this crispr