ID: 911337320

View in Genome Browser
Species Human (GRCh38)
Location 1:96596370-96596392
Sequence CAGAAGTAGGAGAATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911337320_911337327 9 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337327 1:96596402-96596424 CCACCTCCAGGTCTGCCCCTAGG No data
911337320_911337328 10 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337320_911337323 -3 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337320_911337329 11 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337329 1:96596404-96596426 ACCTCCAGGTCTGCCCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911337320 Original CRISPR CAGAAGTAGGAGAATGTGGC TGG (reversed) Intergenic
No off target data available for this crispr