ID: 911337323

View in Genome Browser
Species Human (GRCh38)
Location 1:96596390-96596412
Sequence CTGATATCCGTCCCACCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911337316_911337323 6 Left 911337316 1:96596361-96596383 CCCCCTTTTCCAGCCACATTCTC No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337321_911337323 -7 Left 911337321 1:96596374-96596396 CCACATTCTCCTACTTCTGATAT No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337319_911337323 3 Left 911337319 1:96596364-96596386 CCTTTTCCAGCCACATTCTCCTA No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337318_911337323 4 Left 911337318 1:96596363-96596385 CCCTTTTCCAGCCACATTCTCCT No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337320_911337323 -3 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337317_911337323 5 Left 911337317 1:96596362-96596384 CCCCTTTTCCAGCCACATTCTCC No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data
911337315_911337323 10 Left 911337315 1:96596357-96596379 CCTTCCCCCTTTTCCAGCCACAT No data
Right 911337323 1:96596390-96596412 CTGATATCCGTCCCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911337323 Original CRISPR CTGATATCCGTCCCACCTCC AGG Intergenic
No off target data available for this crispr