ID: 911337328

View in Genome Browser
Species Human (GRCh38)
Location 1:96596403-96596425
Sequence CACCTCCAGGTCTGCCCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911337318_911337328 17 Left 911337318 1:96596363-96596385 CCCTTTTCCAGCCACATTCTCCT No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337320_911337328 10 Left 911337320 1:96596370-96596392 CCAGCCACATTCTCCTACTTCTG No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337315_911337328 23 Left 911337315 1:96596357-96596379 CCTTCCCCCTTTTCCAGCCACAT No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337322_911337328 -3 Left 911337322 1:96596383-96596405 CCTACTTCTGATATCCGTCCCAC No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337317_911337328 18 Left 911337317 1:96596362-96596384 CCCCTTTTCCAGCCACATTCTCC No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337321_911337328 6 Left 911337321 1:96596374-96596396 CCACATTCTCCTACTTCTGATAT No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337319_911337328 16 Left 911337319 1:96596364-96596386 CCTTTTCCAGCCACATTCTCCTA No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data
911337316_911337328 19 Left 911337316 1:96596361-96596383 CCCCCTTTTCCAGCCACATTCTC No data
Right 911337328 1:96596403-96596425 CACCTCCAGGTCTGCCCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911337328 Original CRISPR CACCTCCAGGTCTGCCCCTA GGG Intergenic
No off target data available for this crispr