ID: 911337618

View in Genome Browser
Species Human (GRCh38)
Location 1:96599687-96599709
Sequence TAGAGGCTGAGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911337608_911337618 15 Left 911337608 1:96599649-96599671 CCAGGTGTGGTGGTGTATGCCCA No data
Right 911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG No data
911337610_911337618 -5 Left 911337610 1:96599669-96599691 CCATAGTCCCAGCTACTTTAGAG No data
Right 911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG No data
911337609_911337618 -4 Left 911337609 1:96599668-96599690 CCCATAGTCCCAGCTACTTTAGA No data
Right 911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911337618 Original CRISPR TAGAGGCTGAGGAGGGAGGA TGG Intergenic
No off target data available for this crispr