ID: 911340300

View in Genome Browser
Species Human (GRCh38)
Location 1:96628092-96628114
Sequence TGTAATTAGGATTTGGAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911340300_911340304 -8 Left 911340300 1:96628092-96628114 CCCTATTCCAAATCCTAATTACA No data
Right 911340304 1:96628107-96628129 TAATTACAACTTAATTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911340300 Original CRISPR TGTAATTAGGATTTGGAATA GGG (reversed) Intergenic
No off target data available for this crispr