ID: 911341277

View in Genome Browser
Species Human (GRCh38)
Location 1:96641812-96641834
Sequence CTAATAAGAAGTAAATCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911341277_911341278 -5 Left 911341277 1:96641812-96641834 CCTGCTGATTTACTTCTTATTAG No data
Right 911341278 1:96641830-96641852 ATTAGCATGTAAGATTAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911341277 Original CRISPR CTAATAAGAAGTAAATCAGC AGG (reversed) Intergenic
No off target data available for this crispr