ID: 911353041

View in Genome Browser
Species Human (GRCh38)
Location 1:96779094-96779116
Sequence TCCAGTATGCTGCTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911353039_911353041 15 Left 911353039 1:96779056-96779078 CCTATAAGGTAGACATTTTTTCA No data
Right 911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 124
911353038_911353041 18 Left 911353038 1:96779053-96779075 CCACCTATAAGGTAGACATTTTT 0: 1
1: 0
2: 1
3: 22
4: 219
Right 911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911353041 Original CRISPR TCCAGTATGCTGCTTCTCAC TGG Intronic
900603158 1:3511795-3511817 TCCATGTTGCTGCTTCCCACGGG - Intronic
900854287 1:5168307-5168329 TAAAGTATGCTGCTTCCAACTGG - Intergenic
901448085 1:9320107-9320129 TCCAGGCGTCTGCTTCTCACCGG + Intronic
901674112 1:10872927-10872949 TCCAGGTTGCAGCTCCTCACAGG - Intergenic
904965880 1:34372231-34372253 CCCTGTATGCAGCTGCTCACAGG - Intergenic
907577967 1:55545715-55545737 TCCAGTAGGCTGCTGATGACAGG + Intergenic
908897970 1:68922754-68922776 ACCATTATTCTGCCTCTCACAGG - Intergenic
910513831 1:88036628-88036650 TCCTCAATTCTGCTTCTCACTGG + Intergenic
910763688 1:90759660-90759682 TCCAGTATCCTCCTTCTCAGTGG - Intergenic
911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG + Intronic
911875712 1:103160539-103160561 TCCAGTGTTCTGTTTCTCTCTGG - Intergenic
915775295 1:158477870-158477892 GCTAGTATGATGCTTCTCTCTGG - Intergenic
917196671 1:172473614-172473636 TCCACTATTCTGCATTTCACTGG - Intergenic
918294654 1:183144934-183144956 TTCACTCTGCTGCTTCTCCCAGG + Exonic
918634707 1:186761646-186761668 TGCAGTATCCTGCCTCTCATAGG + Intergenic
918775911 1:188630510-188630532 TCCAATTTTCAGCTTCTCACAGG + Intergenic
921262067 1:213393480-213393502 TCCTGCATGCTGCTGCTCACAGG + Intergenic
924566991 1:245207248-245207270 TGCAGAAGGGTGCTTCTCACAGG + Intronic
1064903286 10:20317101-20317123 TCCAGTATGATTTTTCACACTGG - Intergenic
1067691026 10:48502462-48502484 CCCAGTTTGCTGCTTCCCACTGG + Intronic
1068529390 10:58167533-58167555 TCCATTTTTGTGCTTCTCACAGG - Intergenic
1073909584 10:108325891-108325913 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
1074418130 10:113285168-113285190 TCAAGTATGATGCATGTCACTGG - Intergenic
1074842953 10:117374079-117374101 TCCAATATGCTGCTTATAAAAGG + Intronic
1079246682 11:18757421-18757443 TCAGGTATGCTCCTCCTCACAGG + Intronic
1080962861 11:37180641-37180663 CCCAGGATGCTGCTTCTCCCTGG - Intergenic
1081041604 11:38221271-38221293 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1081042342 11:38226886-38226908 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1085150582 11:74249866-74249888 TGCAGTAAGCTGCCTCTCTCTGG - Intronic
1086589353 11:88493904-88493926 TCCAGCATGCTGTTTCTCTTTGG - Intergenic
1088920765 11:114258421-114258443 TCCCTTATGCCTCTTCTCACGGG - Intronic
1089115038 11:116087958-116087980 TCCTGTGTGCTGCTCCTCCCTGG - Intergenic
1089726553 11:120485662-120485684 TCCAGTAGGCTGCTTCTCTGAGG + Exonic
1091757883 12:3067135-3067157 CCCAGGAAGCTGCTTCTCCCTGG - Intergenic
1092899205 12:13043012-13043034 TCCTGTCTGCAGTTTCTCACGGG + Intergenic
1093730050 12:22556886-22556908 TTCAGTATGTTGATTCTCAAAGG - Intergenic
1097315529 12:58167051-58167073 CCCAGGAAGTTGCTTCTCACTGG + Intergenic
1098868214 12:75786220-75786242 TTCAGAATTCTGCTGCTCACGGG - Intergenic
1099620907 12:85001935-85001957 TCCACTTTTCTGCTTCTCAGTGG + Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1102097162 12:110249855-110249877 TCCAGTATGCTGCTCCTGCACGG + Intergenic
1106370670 13:29129745-29129767 CCCAGCATGCTGGTTCTCAGGGG + Intronic
1111147845 13:84207753-84207775 TCCAGTAAGCTTCCTCTCTCAGG - Intergenic
1112115430 13:96347004-96347026 TGCAGGATTCGGCTTCTCACTGG - Intronic
1112828961 13:103425074-103425096 CCCAGTATTCGGCTACTCACAGG - Intergenic
1113108186 13:106793456-106793478 TCCAGGAATCTGCATCTCACAGG + Intergenic
1121500171 14:94429290-94429312 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
1122344616 14:101050806-101050828 TCCAGGATGCTGCCCCACACAGG - Intergenic
1124823097 15:33067232-33067254 TCCAGTTTGCTGCTCATCTCAGG + Intronic
1128054754 15:64691363-64691385 TCCACTGTGCTGCTGCTCAAGGG - Intronic
1130179399 15:81609847-81609869 TCCTGTATCCTGTTTCTCAATGG - Intergenic
1134008982 16:10837241-10837263 TGCACTGTGCTGCTTCTCCCAGG + Intergenic
1136626220 16:31463797-31463819 TCTTGTCTGCTTCTTCTCACTGG + Intronic
1138738209 16:59277645-59277667 TCCAGTATGCAGATTCTCTTTGG + Intergenic
1139014992 16:62678996-62679018 TGCAGAAGGGTGCTTCTCACAGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143897829 17:10150534-10150556 TCCAATTTGCTGCCTCTCATAGG - Intronic
1146466261 17:33089085-33089107 GCCATTATTCTGCTTATCACAGG - Intronic
1146525594 17:33564582-33564604 GCCATTATGCTGCTCCTCAGGGG - Intronic
1148450708 17:47776071-47776093 TCCACTATACTGCCTCCCACTGG - Intergenic
1155847184 18:30722835-30722857 TCCAATATCCTGCTTTTCAAGGG - Intergenic
1156153766 18:34276478-34276500 TTCCGGATGCTCCTTCTCACTGG - Intergenic
1157331808 18:46709499-46709521 TCCCATATTCTGCTTCTAACAGG + Intronic
1159649832 18:70964991-70965013 TCCACAGTGATGCTTCTCACTGG - Intergenic
1160312319 18:77807366-77807388 TCCACTAGGCTTCTTCTGACAGG + Intergenic
1162833508 19:13301519-13301541 CCCAGGGTGCTGCTGCTCACTGG + Intronic
1164143263 19:22493255-22493277 CCCAGCACGCTGCTTCTGACAGG + Intronic
1164940604 19:32250262-32250284 TCCAGGAGGCTGGGTCTCACTGG + Intergenic
1164967038 19:32494261-32494283 TCCTGTGTGCTGCATCTGACAGG - Intergenic
926940548 2:18131696-18131718 TGCAGTATGCTGATTTTCTCTGG + Intronic
930218541 2:48722168-48722190 CCCAGGATGCTGCTTCTGAATGG + Intronic
934936793 2:98471548-98471570 GCCATGCTGCTGCTTCTCACAGG + Intronic
935184566 2:100720495-100720517 TCCAGAATTCTTCATCTCACAGG + Intergenic
937258906 2:120573025-120573047 CCCAGCCTGCTGCTTCCCACGGG - Intergenic
937318621 2:120947712-120947734 GCCAGAATGCTGCTCCTCTCTGG - Intronic
938038052 2:128053059-128053081 TCTAGGATGCTGCCTATCACTGG - Intergenic
940135006 2:150425731-150425753 TCCAGAATGCTGCTTAACATCGG + Intergenic
941406449 2:165094874-165094896 TACAGTATTCTGCTTCTAAATGG + Intronic
941986698 2:171517727-171517749 TCCAGTATGCTGCTCTTCTGAGG - Intergenic
1169759000 20:9070515-9070537 TCCAGAATGCTGTTTTTCATAGG + Intronic
1170141066 20:13125278-13125300 TCCAGAATGCTGGTTTTCAGTGG - Intronic
1172117396 20:32581195-32581217 TCCAGTTTGCAGGTTGTCACAGG - Intronic
1172660117 20:36562221-36562243 TCAAATATGCTGCTCCTGACAGG + Intergenic
1173498320 20:43534724-43534746 TCCAGGATCTTGCTTCTGACAGG + Intronic
1174687687 20:52471297-52471319 TCCAAGAAGCTGCTTCTGACTGG - Intergenic
1178431345 21:32521065-32521087 TGCTGGATGCTGCCTCTCACGGG - Intergenic
1183255511 22:36759108-36759130 ACCTGCAGGCTGCTTCTCACAGG - Intronic
1184191088 22:42895001-42895023 ACCAGGATTCTGGTTCTCACAGG - Intronic
952297937 3:32077494-32077516 CCCAGGAAGCTGCTTCTCCCTGG - Intronic
955596554 3:60596627-60596649 CCCTGTATTCTACTTCTCACTGG + Intronic
957248429 3:77741283-77741305 TCCAGAAGGCTGGTTCTAACAGG + Intergenic
961366791 3:126405203-126405225 TACTGTATGCTGCCACTCACAGG - Intronic
963799354 3:149660615-149660637 TCCACTGTGCTGCCTCTTACGGG - Intronic
964056007 3:152458554-152458576 TCCATTGTGCTGCCTCTCTCAGG + Intronic
966931431 3:184678204-184678226 CCCAGTTTGCTGTTCCTCACCGG + Intronic
967940248 3:194760608-194760630 TCCAAAATTCTGATTCTCACTGG + Intergenic
974312935 4:60235772-60235794 TTCAGTATGCTGATTCTCAAAGG + Intergenic
975731796 4:77344638-77344660 TACAATAAGCTGCTTCTCAAAGG + Intronic
975869740 4:78766908-78766930 TCAAGCATGCTGCTTGACACTGG + Intergenic
976370583 4:84284082-84284104 TGCAGCATGCTGCCTCTCTCTGG - Intergenic
978526911 4:109676961-109676983 CCCAGGATGCTGCTGCACACTGG - Intronic
981320908 4:143390177-143390199 TCCACTAAGCTGTTTCTCATTGG + Intronic
982826888 4:160013462-160013484 TCCAGTGTGCTCCTTCTCTCTGG + Intergenic
983009717 4:162532307-162532329 TCCAGGAAGTTGCTTCTCCCTGG - Intergenic
984170213 4:176350189-176350211 CCCAGTGAGCTACTTCTCACAGG - Intergenic
986650507 5:9959024-9959046 TCCAGGAAGTTGCTTCTCCCTGG + Intergenic
989232415 5:39101523-39101545 GCCAATATGATGTTTCTCACAGG + Intergenic
994167738 5:96625814-96625836 TCCTGTCTGCTGCCTGTCACCGG + Intronic
996213471 5:120839900-120839922 TCCAGGAAGTTGCTTCTCCCAGG - Intergenic
996678394 5:126202608-126202630 TCCAGTATGCAGACTCTGACAGG + Intergenic
997400331 5:133597120-133597142 TCCAGTATGCTCCACCTCCCAGG + Intronic
1000545641 5:162597859-162597881 TCCAGTGGGCTGCATGTCACTGG + Intergenic
1005917678 6:30367815-30367837 TCCAGTTTTCTGCCTCTCACTGG + Intergenic
1009746108 6:67818264-67818286 TACACTATGCTGCCTCTCAAGGG - Intergenic
1018297590 6:162365913-162365935 TCCATTATGCATCTTCTCAGTGG - Intronic
1022281468 7:28914739-28914761 TCTGATCTGCTGCTTCTCACTGG - Intergenic
1024347319 7:48326179-48326201 TCCAGTGTGCTGCTTCCAAAAGG - Intronic
1024700788 7:51902022-51902044 TCCAGAATGCGGCCTCTCACGGG - Intergenic
1024724149 7:52173113-52173135 TCCAGAATGCTGCTTCTTATAGG + Intergenic
1032216200 7:129959175-129959197 TCCATTTCACTGCTTCTCACTGG + Intergenic
1032506910 7:132442533-132442555 TCCAATCTGCTGCTTCTCCATGG + Intronic
1032557208 7:132848997-132849019 TCCAGTATTCTGTTTCTGAAAGG + Intronic
1032750226 7:134832205-134832227 TCCAGAAAGCTGTTTCTCTCTGG + Intronic
1034462602 7:151206098-151206120 TCTAGCATGATGCTTCACACGGG - Intergenic
1038108773 8:24469238-24469260 TTCAGTATTGTGCTTCTCAGGGG - Intronic
1039149376 8:34486345-34486367 ACCAATATGCTGCTTTTTACAGG + Intergenic
1040422846 8:47256652-47256674 TCCAGTCCAGTGCTTCTCACAGG + Intergenic
1046599026 8:116296338-116296360 TCCAGTTTGCTGCCTCTTTCTGG - Intergenic
1049185056 8:141245987-141246009 TCCAGTTTGCTGATTTTCAAAGG + Intronic
1050983697 9:12054529-12054551 TGCAGAAGGGTGCTTCTCACAGG - Intergenic
1051686655 9:19665133-19665155 CCCTGTCTACTGCTTCTCACCGG - Intronic
1052620141 9:30898258-30898280 CCCAGGAAGCTGCTTCTCTCTGG - Intergenic
1061466560 9:130785200-130785222 CCCAGTGTGCTGATTTTCACTGG + Intronic
1189274856 X:39778278-39778300 TCCAGTAAGATGCTTCTTCCTGG - Intergenic
1197726411 X:129779912-129779934 TCCTGTATGCTGCTGCTGCCGGG + Intergenic