ID: 911353041

View in Genome Browser
Species Human (GRCh38)
Location 1:96779094-96779116
Sequence TCCAGTATGCTGCTTCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911353038_911353041 18 Left 911353038 1:96779053-96779075 CCACCTATAAGGTAGACATTTTT 0: 1
1: 0
2: 1
3: 22
4: 219
Right 911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 124
911353039_911353041 15 Left 911353039 1:96779056-96779078 CCTATAAGGTAGACATTTTTTCA No data
Right 911353041 1:96779094-96779116 TCCAGTATGCTGCTTCTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911353041 Original CRISPR TCCAGTATGCTGCTTCTCAC TGG Intronic