ID: 911360633 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:96872133-96872155 |
Sequence | TGACTAACCCTACAACTGAT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
911360633_911360635 | 5 | Left | 911360633 | 1:96872133-96872155 | CCTATCAGTTGTAGGGTTAGTCA | No data | ||
Right | 911360635 | 1:96872161-96872183 | CATAATCGTATATTTCTCAAAGG | 0: 1 1: 2 2: 61 3: 324 4: 752 |
||||
911360633_911360636 | 6 | Left | 911360633 | 1:96872133-96872155 | CCTATCAGTTGTAGGGTTAGTCA | No data | ||
Right | 911360636 | 1:96872162-96872184 | ATAATCGTATATTTCTCAAAGGG | 0: 1 1: 0 2: 5 3: 39 4: 334 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
911360633 | Original CRISPR | TGACTAACCCTACAACTGAT AGG (reversed) | Intergenic | ||