ID: 911360635

View in Genome Browser
Species Human (GRCh38)
Location 1:96872161-96872183
Sequence CATAATCGTATATTTCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911360633_911360635 5 Left 911360633 1:96872133-96872155 CCTATCAGTTGTAGGGTTAGTCA No data
Right 911360635 1:96872161-96872183 CATAATCGTATATTTCTCAAAGG No data
911360630_911360635 16 Left 911360630 1:96872122-96872144 CCTCAGGAATGCCTATCAGTTGT No data
Right 911360635 1:96872161-96872183 CATAATCGTATATTTCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911360635 Original CRISPR CATAATCGTATATTTCTCAA AGG Intergenic