ID: 911360636

View in Genome Browser
Species Human (GRCh38)
Location 1:96872162-96872184
Sequence ATAATCGTATATTTCTCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911360630_911360636 17 Left 911360630 1:96872122-96872144 CCTCAGGAATGCCTATCAGTTGT No data
Right 911360636 1:96872162-96872184 ATAATCGTATATTTCTCAAAGGG No data
911360633_911360636 6 Left 911360633 1:96872133-96872155 CCTATCAGTTGTAGGGTTAGTCA No data
Right 911360636 1:96872162-96872184 ATAATCGTATATTTCTCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911360636 Original CRISPR ATAATCGTATATTTCTCAAA GGG Intergenic