ID: 911370199

View in Genome Browser
Species Human (GRCh38)
Location 1:96987166-96987188
Sequence GCCGACAGTGCAGCCTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911370199_911370201 -1 Left 911370199 1:96987166-96987188 CCACAGAAGGCTGCACTGTCGGC No data
Right 911370201 1:96987188-96987210 CTTCCCTACCTTTGAGGTTTTGG No data
911370199_911370200 -7 Left 911370199 1:96987166-96987188 CCACAGAAGGCTGCACTGTCGGC No data
Right 911370200 1:96987182-96987204 TGTCGGCTTCCCTACCTTTGAGG No data
911370199_911370202 0 Left 911370199 1:96987166-96987188 CCACAGAAGGCTGCACTGTCGGC No data
Right 911370202 1:96987189-96987211 TTCCCTACCTTTGAGGTTTTGGG No data
911370199_911370206 22 Left 911370199 1:96987166-96987188 CCACAGAAGGCTGCACTGTCGGC No data
Right 911370206 1:96987211-96987233 GACCCAGACTGATCCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911370199 Original CRISPR GCCGACAGTGCAGCCTTCTG TGG (reversed) Intergenic
No off target data available for this crispr