ID: 911370307

View in Genome Browser
Species Human (GRCh38)
Location 1:96988086-96988108
Sequence CTGGGAACACAGATGGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911370307_911370316 13 Left 911370307 1:96988086-96988108 CCCTTCCCCATCTGTGTTCCCAG No data
Right 911370316 1:96988122-96988144 CCCTTCCATTTTCCTCCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911370307 Original CRISPR CTGGGAACACAGATGGGGAA GGG (reversed) Intergenic
No off target data available for this crispr