ID: 911372908

View in Genome Browser
Species Human (GRCh38)
Location 1:97015415-97015437
Sequence CAAAGCCTTTGTAGCAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
911372908_911372912 16 Left 911372908 1:97015415-97015437 CCAATCCTGCTACAAAGGCTTTG No data
Right 911372912 1:97015454-97015476 ATTGCTGTGTTTACTCACCATGG No data
911372908_911372913 19 Left 911372908 1:97015415-97015437 CCAATCCTGCTACAAAGGCTTTG No data
Right 911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
911372908 Original CRISPR CAAAGCCTTTGTAGCAGGAT TGG (reversed) Intergenic
No off target data available for this crispr